14 linking a gpo to an ou
báo cáo hóa học:" Dimensions and correlates of quality of life according to frailty status: a cross-sectional study on community-dwelling older adults referred to an outpatient geriatric service in Italy" ppt
Ngày tải lên :
20/06/2014, 16:20
... QOL-related groups A P-value less than or equal to 0.05 was assumed to indicate statistical significance As far as multivariate analyses in the total sample were concerned, two models of linear regression ... estimated at more than 30% It was therefore calculated that with a sample of about 240 participants the study would have obtained an almost 80% statistical power at 5% alpha level to detect a difference ... Correlates of QOL according to frailty status In the total sample several variables, including frailty, were significantly associated with a worse QOL at univariate analyses (Table and Additional...
- 10
- 351
- 0
Tài liệu Converting a DataSet to an ADO Recordset docx
Ngày tải lên :
14/12/2013, 18:16
... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored ... Load the ADO recordset into a DataTable OleDbDataAdapter oleDa = new OleDbDataAdapter( ); DataTable dt = new DataTable("Orders"); oleDa.Fill(dt, rs); // Bind the default view of the table to the...
- 15
- 390
- 0
a guide to building outdoor stairs
Ngày tải lên :
17/12/2013, 10:44
... posts to the location of the top and bottom rails The top surface of the upper rail should be 30" to 34" above the tread; the rail should be about 6" above the tread Lay the railing material against ... the posts and lay out angled cuts for any rails that will be fastened between the posts • Cut the railings to length and toenail them with four 8d galvanized nails If you'll be using balusters, ... hangers (Fig 6), or bolt them in place to a joist (Fig 7) If you need to pour a concrete landing pad at the bottom of the stairway, set the stringers in place temporarily and lay out the location...
- 5
- 313
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
Ngày tải lên :
26/01/2014, 10:20
... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...
- 5
- 309
- 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx
Ngày tải lên :
18/03/2014, 01:20
... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS server (http://maple.bioc...
- 8
- 1.1K
- 0
a means to an end the biological basis of aging and death apr 1999
Ngày tải lên :
11/06/2014, 05:26
... susceptibility to disease and accidental death T h e gradual physical weakening that accompanies aging will make an animal more likely to be caught by a predator; diminished immune capacity can make us ... human death have changed dramatically during our history as a species, but maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and ... fascinating of human biological processes xv A Means to an End Aging, Senescence, and Lifespan We are all aware of aging in humans from our earliest years, through normal, daily contacts with family members,...
- 246
- 670
- 0
Describe a visit to an interesting exhibition ppt
Ngày tải lên :
22/07/2014, 04:20
... into a world of imagination and dreams As I strolled through the exhibition halls, I heard the voices of lecturers who were telling the visitors about the artists and their works An oil painting ... rather tired after hours of walking I sat down on a bench and talked to others about the exhibition The exhibition offered me precious minutes of relaxation and enriched my imagination It brought ... me back into my happy and peaceful past, full of love and tenderness, among my dear ones Before leaving the exhibition halls, I bought the postcards of my favorite paintings to keep as souvenirs...
- 5
- 503
- 0
báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps
Ngày tải lên :
10/08/2014, 10:23
... Vincent’s and Mater Health Sydney and the Australian Catholic University, New South Wales, Australia 4National Centre for Clinical Outcomes Research (NaCCOR), Nursing and Midwifery, The Australian Catholic ... physiotherapists and occupational therapists, and involvement of therapy assistants Role sharing and expansion are examples of organisational interventions [35] A more in-depth examination of how therapists ... if the changes in team behaviour were due to the ‘Out-andAbout Implementation Program’ or factors related to the teams and health environment at the time Our next study, a cluster randomised...
- 10
- 295
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... does an intestinal virus change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, ... and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations...
- 4
- 520
- 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
Ngày tải lên :
06/11/2012, 10:35
... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...
- 2
- 525
- 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
Ngày tải lên :
06/11/2012, 10:35
... familiar with Agreeing and Disagreeing, Giving an Explanation or Making an Argument Some thought that Cause and Affect pattern of essay organization should be paid more attention to TWE preparation It ... to the success of an essay The teacher should take more care of this and created more exercises about coherence and unity within a paragraph or an essay Making outlines and drafts in class was ... can’t be said that they can adequately concentrate on the course The teacher should therefore understand their pressure and create a pleasant learning environment: “learn to relax and relax to...
- 48
- 602
- 1
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
Ngày tải lên :
06/11/2012, 10:35
... or outside school have to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can ... parents are important teachers when children are small but they cannot be the best ones all the time There’s still a gap between children and parents in every family WRITING PAPER Name: Group A Paper: ... need to learn from other sources WRITING PAPER Name: Group A Paper: 02F6g Task: 02 AD Write: It’s said that parents are always the best teachers but we strongly disagree with the above statement...
- 4
- 480
- 0
Unit 3: A TRIP TO THE COUNTRYSIDELesson 14
Ngày tải lên :
15/09/2013, 12:10
... could visit Ba’s village again III.Lucky numbers: It’s about 60 kilometers to the north of Ha Noi Ba and his family got to the village by bus The banyan tree is at the entrance to the village ... got to the village by bus Where is the banyan tree ? The banyan tree is at the entrance to the village What did they see on the mountain ? They saw the shrine of a VietNamese hero on the mountain ... GETTING STARTED + LISTEN & READ B LISTEN AND READ II True / False statements prediction: Correct false statements: Ba and his family had a day trip to their home village There is a big old banyan tree...
- 14
- 442
- 0
Nghiên cứu ảnh hưởng của thức ăn và mật độ ươn nuôi tới tỉ lệ sống và mức độ tăng trưởng của cá bống tượng ương từ giai đoạn cá hương lên cá giống
Ngày tải lên :
06/12/2013, 19:34
... Trey Damrey Bakutut Pa boo Pa bou Goby Belantuk Soon hock Marble goby Pla boo jak Marble goby Marbled sleeper Cỏ Bong Cỏ B ng t ng Ngụn ng Khmer Khmer Malay Laotian Laotian English Malay Cantonese ... English Thai English English Vietnamese Vietnamese m t s qu c gia v vựng lónh th Qu c gia Cambodia Cambodia Indonesia Lao People's Dem Lao People's Dem Malaysia Malaysia Singapore Taiwan Thailand United ... 1758 - animals Subkingdom: Bilateria (Hatschek, 1888) Cavalier-Smith, 1983 - bilaterians Branch: Deuterostomia Grobben, 1908 - deuterostomes Infrakingdom: Chordonia (Haeckel, 1874) Cavalier-Smith,...
- 88
- 509
- 0
Tài liệu Returning an Output Parameter Using a DataReader docx
Ngày tải lên :
14/12/2013, 18:16
... data value to the stored procedure and the stored procedure to pass a data value back to the caller Output The parameter is an output parameter allowing the stored procedure to pass a data value ... parameter is an input parameter allowing the caller to pass a data value to the stored procedure The parameter is both an input and output parameter, allowing the caller InputOutput to pass a ... result.ToString( ); Discussion Output parameters allow a stored procedure to pass a data value or cursor variable back to the caller To use an output parameter with a DataReader, add the output parameter...
- 4
- 266
- 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
Ngày tải lên :
22/12/2013, 08:58
... 2006 Acquisition and analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, ... solutions and precision measurements Nucl Instr Meth Phys Res A2 98: 13–21 Bhawalkar D D, Bhujle A G, Fatnani P, Hannurkar P R, Joshi S C, Karmarkar M G, Kotaiah S, Mhaskar S P, Pande S A, Prabhu S ... light ion source development at CEA/Saclay Rev Sci Instrum 75(5): 1414–1416 http://laacg1.lanl.gov Poisson code, Reference manual, LA-UR-87-126, LANL 1987 Jain S K, Jain A, Sharma D, Hannurkar P R...
- 8
- 650
- 0
How to get out of the friendzone: turn your friendship into a relationship
Ngày tải lên :
10/02/2014, 18:17
... Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, Katie badmouthed ... Your buddies all think you guys are in love and tease you about how you’re already married to your friend, and that’s why you never have a date You always shrug them off and tell them that you ... met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started seeing each...
- 240
- 1.1K
- 1
Tài liệu A guide to our identityEmirates General Petroleum Corporation doc
Ngày tải lên :
14/02/2014, 04:20
... If you have any queries about this guide, please contact our brand co-ordinator: brandco-ordinator@emarat.co.ae Pantone ® is a registered trademark of Pantone Inc The colours used throughout ... colour than those shown above should be used The mark should never appear on any other background than those shown above Black background Light four colour background Dark four colour background ... corporate colour background Colour We use silver, green and blue Pantone® Reflex Blue Cyan 100% Magenta 72% Yellow 0% Black 6% Pantone® 348 Cyan 100% Magenta 0% Yellow 80% Black 27% Pantone®...
- 10
- 330
- 0
Tài liệu A Roadmap to Quality - An e-learning Manual for Implementing Total Quality Management doc
Ngày tải lên :
18/02/2014, 11:20
... Japan ASEAN Consultative Committee in Standards and Quality Standards Department, Agency for Industrial Science and Technology, MITI ASEAN/Japan Cooperation Program for Standardization and Total ... education and training in TQM was provided in Japan; and managers from participating companies attended a series of Top Management seminars in different ASEAN countries and AOTS seminars in Tokyo ... sets of actions that you can take to keep your workplaces healthy and comfortable – and to avoid polluting the area around your factory or plant Unit Safety Each year thousands of employees are killed...
- 380
- 623
- 0